ID: 1124237755_1124237770

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1124237755 1124237770
Species Human (GRCh38) Human (GRCh38)
Location 15:28004405-28004427 15:28004449-28004471
Sequence CCCTGACTTCCAAGCTGGGCTGC AGCGGGGCACCCGGACCGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 265} {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!