ID: 1124240132_1124240139

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1124240132 1124240139
Species Human (GRCh38) Human (GRCh38)
Location 15:28021613-28021635 15:28021627-28021649
Sequence CCAGCGGACGCTCCCCAGGAAGA CCAGGAAGACAGGAAGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 100} {0: 2, 1: 0, 2: 6, 3: 43, 4: 587}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!