ID: 1124244457_1124244467

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1124244457 1124244467
Species Human (GRCh38) Human (GRCh38)
Location 15:28057725-28057747 15:28057768-28057790
Sequence CCTCCTGGGCACAAGCCCTCTGA CGCTGCTGCAGGGGAACAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 430} {0: 1, 1: 0, 2: 1, 3: 19, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!