|
Left Crispr |
Right Crispr |
Crispr ID |
1124245647 |
1124245652 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:28069442-28069464
|
15:28069472-28069494
|
Sequence |
CCGGTCTCCCTCTCATGCGGGGC |
GGACTGTACTGCTGCCATCTCGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 3, 2: 0, 3: 13, 4: 170} |
{0: 791, 1: 492, 2: 154, 3: 345, 4: 7246} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|