ID: 1124245647_1124245652

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1124245647 1124245652
Species Human (GRCh38) Human (GRCh38)
Location 15:28069442-28069464 15:28069472-28069494
Sequence CCGGTCTCCCTCTCATGCGGGGC GGACTGTACTGCTGCCATCTCGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 0, 3: 13, 4: 170} {0: 791, 1: 492, 2: 154, 3: 345, 4: 7246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!