ID: 1124249535_1124249544

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1124249535 1124249544
Species Human (GRCh38) Human (GRCh38)
Location 15:28097759-28097781 15:28097796-28097818
Sequence CCATCACCCATCACCAACTGGGA TCACCAGTGCTTCCCTGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 197} {0: 1, 1: 0, 2: 2, 3: 19, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!