ID: 1124259410_1124259418

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1124259410 1124259418
Species Human (GRCh38) Human (GRCh38)
Location 15:28175317-28175339 15:28175340-28175362
Sequence CCCAACCCCTGCTGCAAAGCAGG CAGATACACCAGTGGGCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 256} {0: 1, 1: 0, 2: 2, 3: 16, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!