ID: 1124272976_1124272990

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1124272976 1124272990
Species Human (GRCh38) Human (GRCh38)
Location 15:28300135-28300157 15:28300177-28300199
Sequence CCAAAAGCAAGTACCAATGACTA GGGACATGGACAAAGGCAGCAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 2, 3: 15, 4: 142} {0: 4, 1: 0, 2: 1, 3: 25, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!