|
Left Crispr |
Right Crispr |
| Crispr ID |
1124284432 |
1124284437 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:28388250-28388272
|
15:28388270-28388292
|
| Sequence |
CCATTATTTTGGCTCCAGAGCGG |
CGGCTTTATGGACCACCTGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 9, 2: 9, 3: 6, 4: 73} |
{0: 5, 1: 5, 2: 9, 3: 9, 4: 68} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|