|
Left Crispr |
Right Crispr |
| Crispr ID |
1124302887 |
1124302891 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:28558943-28558965
|
15:28558961-28558983
|
| Sequence |
CCAAGCTCCTGCTGCCACAGGTG |
AGGTGAGCAGCTGCAGCCCCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 3, 2: 3, 3: 54, 4: 446} |
{0: 6, 1: 5, 2: 5, 3: 60, 4: 537} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|