ID: 1124328815_1124328831

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1124328815 1124328831
Species Human (GRCh38) Human (GRCh38)
Location 15:28789528-28789550 15:28789573-28789595
Sequence CCCACGCCCTGGACCAGCCGCCC GGTTGGGGGCACCATCTGGACGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 24, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!