ID: 1124328829_1124328841

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1124328829 1124328841
Species Human (GRCh38) Human (GRCh38)
Location 15:28789562-28789584 15:28789613-28789635
Sequence CCGCAGCAGCTGGTTGGGGGCAC GAGACCCTCCCCTGCCTCCGAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 29, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!