ID: 1124341772_1124341782

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1124341772 1124341782
Species Human (GRCh38) Human (GRCh38)
Location 15:28894521-28894543 15:28894543-28894565
Sequence CCCAGGCCAGAAGAGCCCTCCAG GGCAAAGGGCCAGCCTGGAATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 40, 4: 343} {0: 1, 1: 1, 2: 5, 3: 23, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!