ID: 1124347949_1124347961

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1124347949 1124347961
Species Human (GRCh38) Human (GRCh38)
Location 15:28934857-28934879 15:28934900-28934922
Sequence CCCGTCAGGAGAGCAGGTGGGAA GGGATAGAGCCCGGAGACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 260} {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!