ID: 1124347950_1124347960

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1124347950 1124347960
Species Human (GRCh38) Human (GRCh38)
Location 15:28934858-28934880 15:28934899-28934921
Sequence CCGTCAGGAGAGCAGGTGGGAAG TGGGATAGAGCCCGGAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 361} {0: 1, 1: 0, 2: 0, 3: 15, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!