ID: 1124349916_1124349920

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1124349916 1124349920
Species Human (GRCh38) Human (GRCh38)
Location 15:28947650-28947672 15:28947663-28947685
Sequence CCCACAGCCTCCTGGGAACCAGA GGGAACCAGAGCTCCTTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 323} {0: 1, 1: 0, 2: 1, 3: 23, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!