ID: 1124356146_1124356153

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1124356146 1124356153
Species Human (GRCh38) Human (GRCh38)
Location 15:28996300-28996322 15:28996350-28996372
Sequence CCAGGAAGCTGAGCAGAAGAAAT ATCTTGCCAGGGATGGAGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 363} {0: 1, 1: 0, 2: 0, 3: 11, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!