|
Left Crispr |
Right Crispr |
| Crispr ID |
1124357445 |
1124357450 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:29006488-29006510
|
15:29006533-29006555
|
| Sequence |
CCATTCTCATGCTGCTAATACAG |
TACAAAGGAAAGAGGTTTAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 410, 2: 665, 3: 2345, 4: 2421} |
{0: 114, 1: 1644, 2: 2232, 3: 1635, 4: 1417} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|