ID: 1124372056_1124372068

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1124372056 1124372068
Species Human (GRCh38) Human (GRCh38)
Location 15:29109648-29109670 15:29109684-29109706
Sequence CCACGGACCCATGGGGAGGCTGG GCTGGTGCCCAGAACGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 192} {0: 1, 1: 0, 2: 1, 3: 22, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!