ID: 1124377770_1124377772

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1124377770 1124377772
Species Human (GRCh38) Human (GRCh38)
Location 15:29139632-29139654 15:29139646-29139668
Sequence CCGCAGGTGCAAGTGAGCAGAGG GAGCAGAGGCTGCCACACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 230} {0: 1, 1: 1, 2: 0, 3: 33, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!