ID: 1124390126_1124390135

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1124390126 1124390135
Species Human (GRCh38) Human (GRCh38)
Location 15:29247680-29247702 15:29247707-29247729
Sequence CCAGCTTCCCTCCCCCAACCCTG ATAGCAGCCAACTTTGTTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 167, 4: 1453} {0: 1, 1: 0, 2: 1, 3: 14, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!