ID: 1124396811_1124396817

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1124396811 1124396817
Species Human (GRCh38) Human (GRCh38)
Location 15:29309458-29309480 15:29309490-29309512
Sequence CCTGAACCCTGGCTTTCTTCTCT GCTCAGTGGGCCAAGCACGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 64, 4: 508} {0: 1, 1: 0, 2: 9, 3: 76, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!