ID: 1124405114_1124405121

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1124405114 1124405121
Species Human (GRCh38) Human (GRCh38)
Location 15:29385056-29385078 15:29385080-29385102
Sequence CCCAGGGGGCCCATCAGATCCCC AACTACCACCAGAGTCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160} {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!