ID: 1124415983_1124415985

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1124415983 1124415985
Species Human (GRCh38) Human (GRCh38)
Location 15:29473581-29473603 15:29473613-29473635
Sequence CCTGTGGTCTTGGTTTTAGGACC AAAGATAGACTTCAGTGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 204} {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!