ID: 1124417750_1124417754

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1124417750 1124417754
Species Human (GRCh38) Human (GRCh38)
Location 15:29487783-29487805 15:29487806-29487828
Sequence CCTGGATTCAACTAATTATCCTG CCTCAGCCTCCAGAGCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 226, 3: 7991, 4: 90338} {0: 350, 1: 15254, 2: 223441, 3: 278622, 4: 178387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!