ID: 1124423272_1124423276

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1124423272 1124423276
Species Human (GRCh38) Human (GRCh38)
Location 15:29540471-29540493 15:29540498-29540520
Sequence CCCACCAGGGCTCAGTGAAACTC TAGGCATCACACAAGAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 160} {0: 1, 1: 0, 2: 0, 3: 17, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!