ID: 1124453852_1124453858

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1124453852 1124453858
Species Human (GRCh38) Human (GRCh38)
Location 15:29822506-29822528 15:29822527-29822549
Sequence CCGGCGGGGGCGGGGCTGGACGA GAGGCGAGGCGAGGCGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 203} {0: 2, 1: 11, 2: 29, 3: 104, 4: 1125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!