ID: 1124453852_1124453860

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1124453852 1124453860
Species Human (GRCh38) Human (GRCh38)
Location 15:29822506-29822528 15:29822531-29822553
Sequence CCGGCGGGGGCGGGGCTGGACGA CGAGGCGAGGCGAGGCGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 203} {0: 2, 1: 14, 2: 27, 3: 253, 4: 981}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!