ID: 1124453852_1124453870

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1124453852 1124453870
Species Human (GRCh38) Human (GRCh38)
Location 15:29822506-29822528 15:29822550-29822572
Sequence CCGGCGGGGGCGGGGCTGGACGA GAGGGGGCGGGGCCGCGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 203} {0: 1, 1: 4, 2: 58, 3: 354, 4: 1893}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!