ID: 1124456351_1124456360

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1124456351 1124456360
Species Human (GRCh38) Human (GRCh38)
Location 15:29846289-29846311 15:29846321-29846343
Sequence CCCAGTGAGGGTCCCCCCAGTTC ACCATGCTCCTTCCCAGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 87} {0: 1, 1: 0, 2: 10, 3: 55, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!