ID: 1124469170_1124469181

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1124469170 1124469181
Species Human (GRCh38) Human (GRCh38)
Location 15:29968407-29968429 15:29968454-29968476
Sequence CCGTCGCCCTACGCGCCGCGGGC GTCAGCGGGCACGCGGTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 63} {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!