ID: 1124487731_1124487734

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1124487731 1124487734
Species Human (GRCh38) Human (GRCh38)
Location 15:30134824-30134846 15:30134847-30134869
Sequence CCTCTTCTCTTCCAGAGTGGGAG GCCTCTCCCCTCTCTTAGAGTGG
Strand - +
Off-target summary No data {0: 14, 1: 2, 2: 4, 3: 26, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!