ID: 1124487739_1124487746

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1124487739 1124487746
Species Human (GRCh38) Human (GRCh38)
Location 15:30134853-30134875 15:30134893-30134915
Sequence CCCCTCTCTTAGAGTGGGTGGGG CAGCTTTCCTTGTGAGCCACAGG
Strand - +
Off-target summary No data {0: 14, 1: 6, 2: 4, 3: 16, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!