|
Left Crispr |
Right Crispr |
| Crispr ID |
1124488222 |
1124488231 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:30137908-30137930
|
15:30137939-30137961
|
| Sequence |
CCTACATCATCTGCTACCCTGAA |
AGGTAAGAGGCTCTGGGCGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 21, 1: 1, 2: 11, 3: 20, 4: 214} |
{0: 6, 1: 13, 2: 17, 3: 27, 4: 270} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|