|
Left Crispr |
Right Crispr |
Crispr ID |
1124488225 |
1124488231 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:30137924-30137946
|
15:30137939-30137961
|
Sequence |
CCCTGAAAGATCTGGAGGTAAGA |
AGGTAAGAGGCTCTGGGCGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 10, 1: 11, 2: 24, 3: 16, 4: 198} |
{0: 6, 1: 13, 2: 17, 3: 27, 4: 270} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|