ID: 1124497002_1124497012

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1124497002 1124497012
Species Human (GRCh38) Human (GRCh38)
Location 15:30192858-30192880 15:30192882-30192904
Sequence CCCTGCCTCAGTCTGTCCCAGAG GTGAGGTCAAGGCTGGTGCCAGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 31, 4: 416}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!