ID: 1124497006_1124497014 |
View in Genome Browser |
Spacer: 8 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1124497006 | 1124497014 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 15:30192863-30192885 | 15:30192894-30192916 |
Sequence | CCTCAGTCTGTCCCAGAGGGTGA | CTGGTGCCAGGGCTCTTCACCGG |
Strand | - | + |
Off-target summary | {0: 2, 1: 0, 2: 3, 3: 20, 4: 211} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |