ID: 1124497009_1124497023

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1124497009 1124497023
Species Human (GRCh38) Human (GRCh38)
Location 15:30192874-30192896 15:30192919-30192941
Sequence CCCAGAGGGTGAGGTCAAGGCTG ACCTGGAGAGGGGAGAAAGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!