ID: 1124499958_1124499965

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1124499958 1124499965
Species Human (GRCh38) Human (GRCh38)
Location 15:30219241-30219263 15:30219275-30219297
Sequence CCTCCCAAGCCCATTCTTTGTTA GTCAATACTCATATTAGGTAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!