ID: 1124509417_1124509420

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1124509417 1124509420
Species Human (GRCh38) Human (GRCh38)
Location 15:30310354-30310376 15:30310367-30310389
Sequence CCACCAAAATCCAGGTGGGCCTA GGTGGGCCTAGCTGACACAGTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 8, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!