ID: 1124516478_1124516484

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1124516478 1124516484
Species Human (GRCh38) Human (GRCh38)
Location 15:30370929-30370951 15:30370972-30370994
Sequence CCCTTACTTGGGCCCGGGTGACT ATCACCTTCCAGAGAAAATGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 46} {0: 2, 1: 0, 2: 1, 3: 26, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!