ID: 1124522203_1124522211

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1124522203 1124522211
Species Human (GRCh38) Human (GRCh38)
Location 15:30413908-30413930 15:30413936-30413958
Sequence CCTGGGGTGATTGGCGAGGGCAA GGGCTGCTTGCTGAAGGGGTGGG
Strand - +
Off-target summary {0: 10, 1: 0, 2: 20, 3: 21, 4: 104} {0: 21, 1: 10, 2: 6, 3: 38, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!