ID: 1124522203_1124522216

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1124522203 1124522216
Species Human (GRCh38) Human (GRCh38)
Location 15:30413908-30413930 15:30413961-30413983
Sequence CCTGGGGTGATTGGCGAGGGCAA TGACTGACAAAACTTTGGTGGGG
Strand - +
Off-target summary {0: 10, 1: 0, 2: 20, 3: 21, 4: 104} {0: 9, 1: 11, 2: 12, 3: 20, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!