ID: 1124536341_1124536348

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1124536341 1124536348
Species Human (GRCh38) Human (GRCh38)
Location 15:30551753-30551775 15:30551781-30551803
Sequence CCTCTTCTCTTCCAGAGTGGGAG TCCCCTCTCTTAGAGTGGGTGGG
Strand - +
Off-target summary {0: 10, 1: 0, 2: 2, 3: 32, 4: 301} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!