ID: 1124542817_1124542825

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1124542817 1124542825
Species Human (GRCh38) Human (GRCh38)
Location 15:30603799-30603821 15:30603825-30603847
Sequence CCCCTCTTCTCTTCCAGAGTGGG CCTCTCCCCTCTCTTAGAGTGGG
Strand - +
Off-target summary No data {0: 14, 1: 2, 2: 5, 3: 28, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!