ID: 1124542817_1124542826

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1124542817 1124542826
Species Human (GRCh38) Human (GRCh38)
Location 15:30603799-30603821 15:30603828-30603850
Sequence CCCCTCTTCTCTTCCAGAGTGGG CTCCCCTCTCTTAGAGTGGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!