ID: 1124545845_1124545855

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1124545845 1124545855
Species Human (GRCh38) Human (GRCh38)
Location 15:30626121-30626143 15:30626141-30626163
Sequence CCCCCGTGGTGGCTCCGGGTGTC GTCTGCAGTGGAGCTGGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 92} {0: 1, 1: 0, 2: 7, 3: 119, 4: 1423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!