ID: 1124586054_1124586057

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1124586054 1124586057
Species Human (GRCh38) Human (GRCh38)
Location 15:31008516-31008538 15:31008532-31008554
Sequence CCTAGCCTTTTATTCCTGGGATA TGGGATAAACTACCTGATCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 43, 4: 224} {0: 1, 1: 0, 2: 1, 3: 2, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!