ID: 1124595248_1124595257

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1124595248 1124595257
Species Human (GRCh38) Human (GRCh38)
Location 15:31086574-31086596 15:31086593-31086615
Sequence CCTAGGTCAGCATCCCCACCTCT CTCTCCCAGCAGGGGCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 332} {0: 1, 1: 0, 2: 5, 3: 37, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!