ID: 1124598011_1124598015

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1124598011 1124598015
Species Human (GRCh38) Human (GRCh38)
Location 15:31107090-31107112 15:31107133-31107155
Sequence CCCGCCACTTATATTTTCTGTAA TTCATTCTTCTTTACAAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 479} {0: 1, 1: 3, 2: 39, 3: 353, 4: 1463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!