ID: 1124630998_1124631013

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1124630998 1124631013
Species Human (GRCh38) Human (GRCh38)
Location 15:31337128-31337150 15:31337175-31337197
Sequence CCACAGGGGTGCCATCTGCCCCC TAAGTGGCCTGCGGCAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 35, 4: 318} {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!